Stem-loop sequence pma-mir-456

AccessionMI0017136 (change log)
DescriptionPetromyzon marinus miR-456 stem-loop
Gene family MIPF0000341; mir-456
Stem-loop
          cc     -   g     uu       acac ug    c 
5' guuaugc  gugug cag caucu  ccagccu    g  gggu c
   |||||||  ||||| ||| |||||  |||||||    |  ||||  
3' caguacg  uacac guu guaga  ggucgga    c  cuua u
          --     u   g     uu       ---- gu    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL476784.1: 59312-59396 [+]
intergenic
Database links

Mature sequence pma-miR-456

Accession MIMAT0019554
Sequence

54 - 

caggcugguuagaugguuguca

 - 75

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).