Stem-loop sequence pma-mir-451

Accession MI0017135
Description Petromyzon marinus miR-451 stem-loop
Gene family MIPF0000148; mir-451
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-451_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-451 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. miR-451 regulates the drug-transporter protein P-glycoprotein, potentially promoting resistance to the chemotherapy drug Paclitaxel.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
uug      ug    c a    g          ugu 
   ggggag  gcga a aacc uuaccauuau   a
   ||||||  |||| | |||| ||||||||||    
   ccccuc  cguu u uugg aaugguaaua   a
ucg      gu    c c    g          acc 
Get sequence

Mature sequence pma-miR-451

Accession MIMAT0019553
Sequence

18 - 

aaaccguuaccauuauuguaacca

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).