|
miRBase |
|
Stem-loop sequence pma-mir-281a |
|
| Accession | MI0017120 |
| Description | Petromyzon marinus miR-281a stem-loop |
| Stem-loop |
a cg u u uc g gauuug g ac g cgagcaggggagc c uccaugacggg u | || | ||||||||||||| | ||||||||||| c c ug c gcucguucucucg g agguacuguuc g g au c - uu - augugu |
Mature sequence pma-miR-281a |
|
| Accession | MIMAT0019535 |
| Sequence |
55 - ugucauggaguugcucucuugc - 76 |
| Evidence | experimental; 454 [1] |
References |
|
| 1 |
PMID:20959416
"microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate"
Proc Natl Acad Sci U S A. 107:19379-19383(2010).
|