Stem-loop sequence pma-mir-221

AccessionMI0017118 (change log)
DescriptionPetromyzon marinus miR-221 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   c ag         ug   c         gaga    -  aa 
5'  g  gccuggacc  gca acaguguag    cugu gu  c
    |  |||||||||  ||| |||||||||    |||| ||  c
3'  c  uggacuugg  cgu uguuacauc    gaca cg  a
   c gu         gu   c         ----    a  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-221

Accession MIMAT0019532
Sequence

51 - 

agcuacauugucugcuggguuc

 - 72

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).