Stem-loop sequence pma-mir-210

AccessionMI0017110 (change log)
DescriptionPetromyzon marinus miR-210 stem-loop
Stem-loop
   -  -    u         c       u         uccg 
5'  gc cgug ccggcagcu cugucgc cgcauauug    c
    || |||| ||||||||| ||||||| |||||||||    c
3'  cg gcgu ggcugucgg gacagug gcgugugac    u
   c  c    c         c       u         ucug 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL476669.1: 301617-301697 [-]
intergenic
Database links

Mature sequence pma-miR-210

Accession MIMAT0019522
Sequence

48 - 

gugugcgugugacagcggcugu

 - 69

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).