Stem-loop sequence pma-mir-210

AccessionMI0017110 (change log)
DescriptionPetromyzon marinus miR-210 stem-loop
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -  -    u         c       u         uccg 
5'  gc cgug ccggcagcu cugucgc cgcauauug    c
    || |||| ||||||||| ||||||| |||||||||    c
3'  cg gcgu ggcugucgg gacagug gcgugugac    u
   c  c    c         c       u         ucug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL476669.1: 301617-301697 [-]
intergenic
Database links

Mature sequence pma-miR-210

Accession MIMAT0019522
Sequence

48 - 

gugugcgugugacagcggcugu

 - 69

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).