Stem-loop sequence pma-mir-208

Accession

MI0017109

Description

Petromyzon marinus miR-208 stem-loop

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-208. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-208 is a family of microRNA precursors found in animals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. In humans, the gene for miR-208 is located in an intron of MYH7.

Stem-loop

gaa       a     g    c  c              gg   c 
   guggcgc cgggc ugcu cu gcucguuuuauuuu  aau a
   ||||||| ||||| |||| || ||||||||||||||  ||| a
   cgccgcg gccug guga ga cgagcagaauagaa  uug a
gca       a     g    u  a              -a   a 

Mature sequence pma-miR-208-5p

• Accession: MIMAT0019520
• Previous IDs: pma-miR-208*
• Sequence: 17 - gugcuccucgcucguuuuauuu - 38
• Evidence: experimental; 454 [1]

Mature sequence pma-miR-208-3p

• Accession: MIMAT0019521
• Previous IDs: pma-miR-208
• Sequence: 57 - auaagacgagcaaguagugggu - 78
• Evidence: experimental; 454 [1]

References

1. PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).