Stem-loop sequence pma-mir-205b

Accession

MI0017108

Description

Petromyzon marinus miR-205b stem-loop

Gene family

MIPF0000058; mir-205

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-205. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology miR-205 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. They are involved in numerous cellular processes, including development, proliferation, and apoptosis. Currently, it is believed that miRNAs elicit their effect by silencing the expression of target genes. The miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) and miR-205 are frequently silenced in advanced cancer. Studies has shown that by targeting the transcriptional repressors of E-cadherin, ZEB1 and ZEB2, it is involved in epithelial to mesenchymal transition (EMT) and tumor invasion. Recently, miR-200 silencing was also reported in cancer stem cells, implying that miR-200 deregulation is a key event in multiple levels of tumor biology. However, what prevents miR-200 expression remains largely unanswered.

Stem-loop

   u  cc        c           uuaac  a 
cug ug  cuucauuc accggagucug     gc a
||| ||  |||||||| |||||||||||     ||  
gac ac  gaaguagg uggccuuagac     cg g
   c  cu        c           cgcac  g 

Mature sequence pma-miR-205b

• Accession: MIMAT0019519
• Sequence: 7 - cccuucauuccaccggagucugu - 29
• Evidence: experimental; 454 [1]

References

1. PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).