Stem-loop sequence pma-mir-194

Accession

MI0017098

Description

Petromyzon marinus miR-194 stem-loop

Gene family

MIPF0000055; mir-194

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-194_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-194 microRNA precursor is a small non-coding RNA gene that regulated gene expression. Its expression has been verified in mouse (MI0000236, MI0000733) and in human (MI0000488, MI0000732). mir-194 appears to be a vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000055). The mature microRNA is processed from the longer hairpin precursor by the Dicer enzyme. In this case, the mature sequence is excised from the 5' arm of the hairpin.

Stem-loop

cac     g       u       c        gu   u  uc 
   agugu caucagg guaacag aacuccau  gga gu  c
   ||||| ||||||| ||||||| ||||||||  ||| ||   
   uuaca guaguuu cauuguc uugaggug  ccu cg  a
cac     g       u       a        ac   -  cu 

Mature sequence pma-miR-194-5p

• Accession: MIMAT0019500
• Previous IDs: pma-miR-194
• Sequence: 17 - uguaacagcaacuccauguggau - 39
• Evidence: experimental; 454 [1]

Mature sequence pma-miR-194-3p

• Accession: MIMAT0019501
• Previous IDs: pma-miR-194*
• Sequence: 53 - caguggaguuacuguuacuuuu - 74
• Evidence: experimental; 454 [1]

References

1. PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).