Stem-loop sequence pma-mir-153-2

AccessionMI0017086 (change log)
DescriptionPetromyzon marinus miR-153-2 stem-loop
Gene family MIPF0000050; mir-153
Stem-loop
   cgg      -              -       -----  u 
5'    cugaug ucauuuuugugauu ugcaacu     cg u
      |||||| |||||||||||||| |||||||     || u
3'    gacuac agugaaaacacuga acguuga     gc u
   gga      u              u       agugu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-153-3p

Accession MIMAT0019484
Previous IDspma-miR-153
Sequence

47 - 

uugcauagucacaaaagugaucau

 - 70

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).