Stem-loop sequence pma-mir-135b

AccessionMI0017072 (change log)
DescriptionPetromyzon marinus miR-135b stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   uc    -                a           uc  aac c 
5'   cccg cguuguauggcuuuuu uuccuacguga  gu   g a
     |||| |||||||||||||||| |||||||||||  ||   |  
3'   gggc gcaacguaccgaaagg agggauguacu  cg   c c
   gu    a                -           -c  agu g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-135b

Accession MIMAT0019465
Sequence

12 - 

uauggcuuuuuauuccuacguga

 - 34

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).