Stem-loop sequence pma-mir-135a

AccessionMI0017071 (change log)
DescriptionPetromyzon marinus miR-135a stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   u    u     c            u            --    u 
5'  ugua cugug uuuauggcuuuu auuccuauguga  uugc u
    |||| ||||| |||||||||||| ||||||||||||  ||||  
3'  acgu ggcac agguaccgaaag uggggaugcgcu  aaug c
   a    -     a            -            cc    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL476647.1: 647673-647758 [-]
intergenic
Database links

Mature sequence pma-miR-135a-5p

Accession MIMAT0019463
Previous IDspma-miR-135a
Sequence

15 - 

uauggcuuuuuauuccuauguga

 - 37

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-miR-135a-3p

Accession MIMAT0019464
Previous IDspma-miR-135a*
Sequence

54 - 

gcguaggggugaaagccaugga

 - 75

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).