Stem-loop sequence pma-mir-130c

AccessionMI0017067 (change log)
DescriptionPetromyzon marinus miR-130c stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
         -       uc     u   -c         - cu    g 
5' uuuccc ccgucgc  gcuuu uua  uguugcacu c  guug a
   |||||| |||||||  ||||| |||  ||||||||| |  |||| u
3' agaggg ggcggcg  cggga aau  acaacguga g  uagc g
         c       ca     u   au         c ag    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-130c

Accession MIMAT0019457
Sequence

54 - 

cagugcaacauauaauagggcac

 - 76

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).