Stem-loop sequence pma-mir-130d

AccessionMI0017063 (change log)
DescriptionPetromyzon marinus miR-130d stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   gga   c           --       c    c   -  ga 
5'    cga ccgaugcccuu  ucaacgu gcac gcu gu  g
      ||| |||||||||||  ||||||| |||| ||| ||  c
3'    gcu ggcuacgggaa  aguugua cgug cga cg  a
   uug   u           aa       a    a   g  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-130d

Accession MIMAT0019452
Sequence

49 - 

cagugcaauguugaaaaagggcau

 - 72

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).