Stem-loop sequence pma-mir-128-1

AccessionMI0017060 (change log)
DescriptionPetromyzon marinus miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   u    -   c   cu        uca     ccc  g   aaug 
5'  gggu guc ggg  ggaggccg   cacug   ga agc    a
    |||| ||| |||  ||||||||   |||||   || |||     
3'  ccca cgg ccc  ucucuggc   gugac   cu ucg    g
   c    a   u   uu        caa     acu  g   gucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL476334.1: 422133-422221 [+]
intergenic
Database links

Mature sequence pma-miR-128

Accession MIMAT0019449
Sequence

56 - 

ucacagugaaccggucucuuuc

 - 77

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).