Stem-loop sequence pma-mir-103a

Accession

MI0017055

Description

Petromyzon marinus miR-103a stem-loop

Gene family

MIPF0000024; mir-103

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Stem-loop

--c    cc     -   u  c           c   ugu  aac 
   cgcu  uuuca gcc cu uauggugcugc uug   ca   c
   ||||  ||||| ||| || ||||||||||| |||   ||    
   guga  aaggu cgg ga augcuacgacg aac   gu   u
gcu    --     u   -  c           -   --u  gcg 

Mature sequence pma-miR-103a

• Accession: MIMAT0019441
• Sequence: 53 - agcagcaucguacagggcuugga - 75
• Evidence: experimental; 454 [1]

References

1. PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).