Stem-loop sequence pma-mir-92a

AccessionMI0017050 (change log)
DescriptionPetromyzon marinus miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ccu   c          a       ca        u  c 
5'    guc cgcugagguc ggauggg  gcaaugcg ga u
      ||| |||||||||| |||||||  |||||||| || a
3'    uag gcgauuccgg ccugcuc  cguuaugu cu g
   auu   a          c       -a        c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL478379.1: 407029-407108 [+]
intergenic
Clustered miRNAs
< 10kb from pma-mir-92a
pma-mir-17aGL478379.1: 403379-403460 [+]
pma-mir-18bGL478379.1: 403671-403761 [+]
pma-mir-17bGL478379.1: 404297-404390 [+]
pma-mir-19cGL478379.1: 404996-405075 [+]
pma-mir-20aGL478379.1: 406609-406699 [+]
pma-mir-19bGL478379.1: 406814-406897 [+]
pma-mir-92aGL478379.1: 407029-407108 [+]
pma-mir-25bGL478379.1: 408922-409013 [+]
Database links

Mature sequence pma-miR-92a

Accession MIMAT0019435
Sequence

49 - 

uauugcacucgucccggccuua

 - 70

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).