Stem-loop sequence pma-mir-33b

AccessionMI0017049 (change log)
DescriptionPetromyzon marinus miR-33b stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   c g  a   u                      u    u 
5'  c cu ugc gcauuguuguugcauugcaucc gcag g
    | || ||| |||||||||||||||||||||| ||||  
3'  g ga acg cgugacaaugauguagcguggg uguu c
   a a  c   u                      -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-33b

Accession MIMAT0019434
Sequence

9 - 

cugcauuguuguugcauugcau

 - 30

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).