Stem-loop sequence pma-mir-31

AccessionMI0017047 (change log)
DescriptionPetromyzon marinus miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
     u     a     aag    ugg         -  ac 
5' ac ggacg guggc   augc   cauagccgc uc  u
   || ||||| |||||   ||||   ||||||||| ||  c
3' ug ucugc caccg   uacg   gugucggcg ag  u
     u     c     gga    uca         g  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-31

Accession MIMAT0019432
Sequence

11 - 

uggcaagaugcuggcauagcc

 - 31

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).