Stem-loop sequence pma-mir-29d

AccessionMI0017038 (change log)
DescriptionPetromyzon marinus miR-29d stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   cu     u    -          cg     g  -u   cu  g 
5'   gcucc ggga gcugguuuca  uggug cu  aga  gu a
     ||||| |||| ||||||||||  ||||| ||  |||  || u
3'   ugagg cccu uggcuaaagu  accac ga  ucu  cg g
   gu     u    g          au     -  uc   uc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL477440.1: 2295-2380 [+]
intergenic
Clustered miRNAs
< 10kb from pma-mir-29d
pma-mir-29dGL477440.1: 2295-2380 [+]
pma-mir-29aGL477440.1: 3408-3490 [+]
Database links

Mature sequence pma-miR-29d-5p

Accession MIMAT0019420
Previous IDspma-miR-29d*
Sequence

14 - 

cugguuucacgugguggcuuaga

 - 36

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-miR-29d-3p

Accession MIMAT0019421
Previous IDspma-miR-29d
Sequence

54 - 

uagcaccauaugaaaucgguguc

 - 76

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).