Stem-loop sequence pma-mir-29b

AccessionMI0017036 (change log)
DescriptionPetromyzon marinus miR-29b stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
     a                 ccu       -u    gug 
5' cg cucgcgugaccgauuuc   ugguguu  agau   g
   || |||||||||||||||||   |||||||  ||||   a
3' gc gggcguauuggcuaaag   accacga  ucug   u
     -                 auu       uc    gug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-29b

Accession MIMAT0019418
Sequence

50 - 

uagcaccauuagaaaucgguua

 - 71

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).