Stem-loop sequence pma-mir-29a

AccessionMI0017035 (change log)
DescriptionPetromyzon marinus miR-29a stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   -----ac   g            ucu       u   guu   ua 
5'        cca augacugauuuc   ugguguu aga   ccg  u
          ||| ||||||||||||   ||||||| |||   |||   
3'        ggu uauugacuaaag   accacga ucu   ggu  g
   ugggaga   g            uuu       -   ---   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL477440.1: 3408-3490 [+]
intergenic
Clustered miRNAs
< 10kb from pma-mir-29a
pma-mir-29dGL477440.1: 2295-2380 [+]
pma-mir-29aGL477440.1: 3408-3490 [+]
Database links

Mature sequence pma-miR-29a-5p

Accession MIMAT0019416
Previous IDspma-miR-29a*
Sequence

10 - 

acugauuucucuugguguuuaga

 - 32

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-miR-29a-3p

Accession MIMAT0019417
Previous IDspma-miR-29a
Sequence

50 - 

uagcaccauuugaaaucaguua

 - 71

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).