miRBase
|
|
miRBase |
|
|
||
Stem-loop sequence pma-mir-27a |
|||||||||||||||||||||||||||||||||||||||||||||||
| Accession | MI0017033 | ||||||||||||||||||||||||||||||||||||||||||||||
| Description | Petromyzon marinus miR-27a stem-loop | ||||||||||||||||||||||||||||||||||||||||||||||
| Gene family | MIPF0000036; mir-27 | ||||||||||||||||||||||||||||||||||||||||||||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours. Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages: You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages. Please note, we're not responsible for the content of Wikipedia pages. You can read more about miRBase, Wikipedia and community annotation on this blog post. Please email us for help or with comments about this community annotation initiative. miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.
miR-27 is a family of microRNA precursors found in animals, including humans.[1] MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product.[2] The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell.[3] It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.[4]
[edit] Regulation of adipocyte differentiationmiR-27 is one of a number of microRNAs implicated in cholesterol homeostasis and fatty acid metabolism.[5] The miR-27 gene family has been shown to be downregulated during the differentiation of adipocytes. miR-27 overexpression inhibits adipocyte formation when overexpressed, acting by blocking the expression of two main regulators of adipogenesis.[6] MicroRNAs miR-27a and -27b have been found to negatively regulate adipocyte differentiation through regulation of the peroxisome proliferator-activated receptor gamma (PPARγ) post-transcriptionally, as well as C/EBP alpha in the case of miR-27b.[7] miR-27 can be identified both as an adipogenic inhibitor and as playing an important role in the development of obesity.[6] [edit] Wnt signalling pathwaymiR-27 is an activator of the Wnt signalling pathway, affecting the differentiation of mesenchymal stem cells into osteoblasts.[8] miR-27 has been found to target and inhibit gene expression of the adenomatous polyposis coli (APC) protein, enabling it to regulate osteoblast differentiation. Expression levels of miR-27 are positively correlated with beta-catenin,[9] a key protein in Wnt signalling. There is activation of Wnt signalling through nuclear accumulation of this protein, which is in response to inhibition of the beta-catenin destruction complex. This in turn is brought about by APC inhibition of miR-27.[9] [edit] Cancer RegulationmiR-27 is known to regulate components involved in numerous types of cancer, including breast[10][11] and ovarian.[12] miR-27a has been identified as an oncogenic microRNA and, specifically, is highly expressed in breast cancer cells. Inhibition of miR-27 by antisense molecules decreases cell proliferation.[13] Antisense RNA directed against miR-27a has been shown to decrease the percentage of cells in S phase whilst also increasing those in the G2-M phase.[14] The FOXO (Forkhead Box O) gene sub-family encodes tumour-suppressive transcription factors that regulate multiple aspects of cell cycle progression and survival. FOXO1 protein expression is down-regulated in breast tumour tissue samples; miR-27a has been identified as one of three miRNAS (along with miR-96 and miR-182) which directly target FOXO1 and regulate its endogenous expression. Suppression of miR-27a results in a FOXO1 protein increase and a consequent cell number decrease.[14] [edit] References
[edit] External links
|
||||||||||||||||||||||||||||||||||||||||||||||
| Stem-loop |
gca ca ug u u cuug gug ggacuuagu cu gugagcag gc c ||| ||||||||| || |||||||| || cac cuugaaucg ga cacuuguu ug u cuc ac gu - c ucuuGet sequence |
||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence pma-miR-27a |
|
| Accession | MIMAT0019413 |
| Sequence |
50 - uucacaguggcuaaguuccac - 70 |
| Evidence | experimental; 454 [1] |
References |
|
| 1 |
PMID:20959416
"microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate"
Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ
Proc Natl Acad Sci U S A. 107:19379-19383(2010).
|
Comments, questions? Email mirbase@manchester.ac.uk
