Stem-loop sequence pma-mir-26b

AccessionMI0017032 (change log)
DescriptionPetromyzon marinus miR-26b stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
   cug     gg             a  c         ----    u 
5'    gccgu  ccugauucaagua uc aggauaggu    uggu u
      |||||  ||||||||||||| || |||||||||    |||| a
3'    cggcg  ggauuggguucau ag uccuauccg    acca u
   agg     ga             c  c         agag    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL476522.1: 359432-359520 [+]
intergenic
Database links

Mature sequence pma-miR-26b-5p

Accession MIMAT0019411
Previous IDspma-miR-26b
Sequence

16 - 

uucaaguaauccaggauagguu

 - 37

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-miR-26b-3p

Accession MIMAT0019412
Previous IDspma-miR-26b*
Sequence

55 - 

ccuauccucgacuacuuggguu

 - 76

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).