Stem-loop sequence pma-mir-26a-2

AccessionMI0017031 (change log)
DescriptionPetromyzon marinus miR-26a-2 stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
   cuu       a     u u          c    u   - ug  u 
5'    uaggcug caccc g ucaaguaauc agga agg c  ug u
      ||||||| ||||| | |||||||||| |||| ||| |  || a
3'    gucugau guggg c aguucguugg uccu ucc g  gc c
   aac       -     c u          c    u   g gu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL477073.1: 186582-186672 [+]
intergenic
Database links

Mature sequence pma-miR-26a-5p

Accession MIMAT0019408
Previous IDspma-miR-26a
Sequence

19 - 

uucaaguaauccaggauaggcu

 - 40

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-miR-26a-2-3p

Accession MIMAT0019410
Previous IDspma-miR-26a-2*
Sequence

55 - 

ccuuuccucgguugcuugaucc

 - 76

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).