Stem-loop sequence pma-mir-19c

AccessionMI0017021 (change log)
DescriptionPetromyzon marinus miR-19c stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
   c u              ---         u  gg   ugcc 
5'  c cugucaguuuugca   gauuugcac gc  ugg    u
    | ||||||||||||||   ||||||||| ||  |||     
3'  g gguagucaaaacgu   cuaaacgug cg  acc    c
   a c              ccc         u  -a   cuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL478379.1: 404996-405075 [+]
intergenic
Clustered miRNAs
< 10kb from pma-mir-19c
pma-mir-17aGL478379.1: 403379-403460 [+]
pma-mir-18bGL478379.1: 403671-403761 [+]
pma-mir-17bGL478379.1: 404297-404390 [+]
pma-mir-19cGL478379.1: 404996-405075 [+]
pma-mir-20aGL478379.1: 406609-406699 [+]
pma-mir-19bGL478379.1: 406814-406897 [+]
pma-mir-92aGL478379.1: 407029-407108 [+]
pma-mir-25bGL478379.1: 408922-409013 [+]
Database links

Mature sequence pma-miR-19c

Accession MIMAT0019394
Sequence

51 - 

ugugcaaauccccugcaaaacuga

 - 74

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).