Stem-loop sequence pma-mir-18b

AccessionMI0017018 (change log)
DescriptionPetromyzon marinus miR-18b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
      -   g      --ua    u    u   u    a   -ug  au 
5' gug cuu cuugug    aagg gcau uag gcag uag   gc  a
   ||| ||| ||||||    |||| |||| ||| |||| |||   ||  g
3' cac gaa gaacac    uucc cgug auc cguc auc   cg  c
      u   -      uuuc    u    u   u    -   uua  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL478379.1: 403671-403761 [+]
intergenic
Clustered miRNAs
< 10kb from pma-mir-18b
pma-mir-17aGL478379.1: 403379-403460 [+]
pma-mir-18bGL478379.1: 403671-403761 [+]
pma-mir-17bGL478379.1: 404297-404390 [+]
pma-mir-19cGL478379.1: 404996-405075 [+]
pma-mir-20aGL478379.1: 406609-406699 [+]
pma-mir-19bGL478379.1: 406814-406897 [+]
pma-mir-92aGL478379.1: 407029-407108 [+]
pma-mir-25bGL478379.1: 408922-409013 [+]
Database links

Mature sequence pma-miR-18b-5p

Accession MIMAT0019389
Previous IDspma-miR-18b
Sequence

15 - 

aaaggugcauuuagugcagauag

 - 37

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-miR-18b-3p

Accession MIMAT0019390
Previous IDspma-miR-18b*
Sequence

56 - 

acugcucuaugugcuccuucuuu

 - 78

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).