Stem-loop sequence pma-mir-18a

AccessionMI0017017 (change log)
DescriptionPetromyzon marinus miR-18a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   ccu   -   g      --cu    u    c   u    a    uccgcu 
5'    gug cuu cuugug    aagg gcau uag gcag uagu      g
      ||| ||| ||||||    |||| |||| ||| |||| ||||       
3'    cac gga gaacac    uucc cgug auc cguc aucg      c
   ucg   u   -      ccau    u    u   u    -    uaaaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-18a-5p

Accession MIMAT0019387
Previous IDspma-miR-18a
Sequence

18 - 

uaaggugcaucuagugcagauag

 - 40

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-miR-18a-3p

Accession MIMAT0019388
Previous IDspma-miR-18a*
Sequence

58 - 

uacugcucuaugugcuccuuua

 - 79

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).