Stem-loop sequence pma-mir-16

AccessionMI0017013 (change log)
DescriptionPetromyzon marinus miR-16 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   c      c           u            -  ga 
5'  cugcac guagcagcacg aaauauuggagu gu  a
    |||||| ||||||||||| |||||||||||| ||  c
3'  ggcgug cgucgucgugc uuuaugaccuua cg  u
   u      u           -            g  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-16-5p

Accession MIMAT0019381
Previous IDspma-miR-16
Sequence

10 - 

uagcagcacguaaauauuggagu

 - 32

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-miR-16-3p

Accession MIMAT0019382
Previous IDspma-miR-16*
Sequence

47 - 

uccaguauuucgugcugcugcug

 - 69

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).