Stem-loop sequence pma-mir-15b

AccessionMI0017012 (change log)
DescriptionPetromyzon marinus miR-15b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   g  -           ua  a     u     a     ggug 
5'  gc ccuuggcgccg  gc gcaca caugg uugcg    u
    || |||||||||||  || ||||| ||||| |||||    u
3'  cg gggaccguggu  cg cgugu guacc aacgu    g
   g  a           uc  g     c     g     agau 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL480635.1: 7879-7962 [+]
intergenic
Database links

Mature sequence pma-miR-15b

Accession MIMAT0019380
Sequence

15 - 

uagcagcacaucauggauugcg

 - 36

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).