Stem-loop sequence pma-mir-9a-2

AccessionMI0017007 (change log)
DescriptionPetromyzon marinus miR-9a-2 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   uucu   agg     uc               g     gu  g 
5'     agu   uggua  uuugguuaucuagcu uauga  gu u
       |||   |||||  ||||||||||||||| |||||  || c
3'     uca   accau  aagccaauagaucga auacu  cg u
   accu   gca     ga               a     gc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL492128.1: 47-135 [+]
intergenic
Database links

Mature sequence pma-miR-9a-5p

Accession MIMAT0019373
Previous IDspma-miR-9a
Sequence

16 - 

ucuuugguuaucuagcuguaug

 - 37

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-miR-9a-3p

Accession MIMAT0019374
Previous IDspma-miR-9a*
Sequence

55 - 

uaaagcuagauaaccgaaagua

 - 76

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).