Stem-loop sequence pma-mir-9a-1

AccessionMI0017006 (change log)
DescriptionPetromyzon marinus miR-9a-1 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   a       -c     uc        uc     g    a   uca 
5'  gggacgg  cccug  uuugguua  uagcu uaug gug   g
    |||||||  |||||  ||||||||  ||||| |||| |||   a
3'  ccuugcc  gggac  aaaccaau  aucga auac cgc   a
   -       ua     ga        uc     a    -   ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-9a-5p

Accession MIMAT0019373
Previous IDspma-miR-9a
Sequence

15 - 

ucuuugguuaucuagcuguaug

 - 36

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).