Stem-loop sequence mmu-mir-3473b

AccessionMI0016997 (change log)
Symbol MGI:Mir3473b
DescriptionMus musculus miR-3473b stem-loop
Gene family MIPF0001230; mir-3473
Literature search

9 open access papers mention mmu-mir-3473b
(188 sentences)

Stem-loop
                       --       
5' cugagccaucucuccagccc  aagauu 
   ||||||||||||||||||||  ||||| a
3' gacucgguagagaggucggg  uuuugg 
                       aa       
Get sequence
Deep sequencing
56034 reads, 553 reads per million, 136 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 41670739-41670793 [+]
antisense
ENSMUST00000099932 ; Ccdc162-202; intron 1
ENSMUST00000019955 ; Ccdc162-201; intron 1
Database links

Mature sequence mmu-miR-3473b

Accession MIMAT0020367
Sequence

36 - 

gggcuggagagauggcucag

 - 55

Get sequence
Deep sequencing55696 reads, 103 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:20933514 "The small RNA expression profile of the developing murine urinary and reproductive systems" Aguilar AL, Piskol R, Beitzinger M, Zhu JY, Kruspe D, Aszodi A, Moser M, Englert C, Meister G FEBS Lett. 584:4426-4434(2010).