|
miRBase |
|
Stem-loop sequence hsa-mir-3975 |
|||||
| Accession | MI0016993 | ||||
| Description | Homo sapiens miR-3975 stem-loop | ||||
| Stem-loop |
- g - - -- aaaag u caugu aggu agug auu gcu auuuc ac a ||||| |||| |||| ||| ||| ||||| || g guaca uuca ucac uaa cgg uaaag ug a c - g u ag ---ga g |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-3975 |
|
| Accession | MIMAT0019360 |
| Sequence |
46 - ugaggcuaaugcacuacuucac - 67 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20876853
"Complete characterization of the microRNAome in a patient with acute myeloid leukemia"
Blood. 116:5316-5326(2010).
|