Stem-loop sequence hsa-mir-3973

Accession

MI0016991

Description

Homo sapiens miR-3973 stem-loop

Stem-loop

  cc   g   cucu       gc     -a      agga        -  c     
gc  agg uag    cuguauu  uuguu  cauuuu    uugcuugc cc uugc 
||  ||| |||    |||||||  |||||  ||||||    |||||||| || ||| u
cg  ucc auu    gacauga  aacaa  guaaag    gacggacg gg aacc 
  au   g   --ac       --     ac      --aa        u  u     

Deep sequencing

3 reads, 2 experiments

Genome context

• Coordinates (GRCh37.p5): chr11: 36031648-36031754 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000389083 ; LDLRAD3-002; intron 1

  OTTHUMT00000389084 ; LDLRAD3-003; intron 1

  OTTHUMT00000389085 ; LDLRAD3-001; intron 1

  OTTHUMT00000389083 ; LDLRAD3-002; intron 1

  OTTHUMT00000389084 ; LDLRAD3-003; intron 1

  OTTHUMT00000389085 ; LDLRAD3-001; intron 1

  OTTHUMT00000389083 ; LDLRAD3-002; intron 1

  OTTHUMT00000389084 ; LDLRAD3-003; intron 1

  OTTHUMT00000389085 ; LDLRAD3-001; intron 1

  OTTHUMT00000389086 ; LDLRAD3-004; intron 2

  OTTHUMT00000389086 ; LDLRAD3-004; intron 2

  OTTHUMT00000389086 ; LDLRAD3-004; intron 2

  ENST00000528989 ; LDLRAD3-002; intron 1

  ENST00000524419 ; LDLRAD3-003; intron 1

  ENST00000315571 ; LDLRAD3-001; intron 1

  ENST00000545142 ; LDLRAD3-201; intron 1

  ENST00000528989 ; LDLRAD3-002; intron 1

  ENST00000524419 ; LDLRAD3-003; intron 1

  ENST00000315571 ; LDLRAD3-001; intron 1

  ENST00000545142 ; LDLRAD3-201; intron 1

  ENST00000528989 ; LDLRAD3-002; intron 1

  ENST00000524419 ; LDLRAD3-003; intron 1

  ENST00000315571 ; LDLRAD3-001; intron 1

  ENST00000532490 ; LDLRAD3-004; intron 2

  ENST00000532490 ; LDLRAD3-004; intron 2

  ENST00000532490 ; LDLRAD3-004; intron 2

Database links

• ENTREZGENE: 100616311;MIR3973

Mature sequence hsa-miR-3973

• Accession: MIMAT0019358
• Sequence: 84 - acaaaguacagcauuagccuuag - 106
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3973
  • MIRDB:hsa-miR-3973
  • TARGETMINER:hsa-miR-3973

References

1. PMID:20876853 "Complete characterization of the microRNAome in a patient with acute myeloid leukemia" Ramsingh G, Koboldt DC, Trissal M, Chiappinelli KB, Wylie T, Koul S, Chang LW, Nagarajan R, Fehniger TA, Goodfellow P, Magrini V, Wilson RK, Ding L, Ley TJ, Mardis ER, Link DC Blood. 116:5316-5326(2010).