Stem-loop sequence bgy-MIR396b

AccessionMI0016984 (change log)
DescriptionBruguiera gymnorhiza miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

1 open access papers mention bgy-MIR396b
(8 sentences)

Stem-loop
   augcua                 a     u  --aac    uuu    a 
5'       uuccacagcuuucuuga cuuuc ug     ugcu   uaua u
         ||||||||||||||||| ||||| ||     ||||   |||| u
3'       agggugucgaaagaacu gaagg ac     acga   augu u
   uacaaa                 c     u  auacc    uau    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bgy-miR396b

Accession MIMAT0020962
Sequence

7 - 

uuccacagcuuucuugaacuu

 - 27

Get sequence
Evidence experimental; Northern [1], RTPCR [1]

References

1
"Identification of microRNA precursors in Bruguiera spp." Lee WS, Li LP, Ling HC, Harikrishna JA Botanica Marina. 54:313-324 (2011).