Stem-loop sequence mmu-mir-3971

Accession MI0016981
Description Mus musculus miR-3971 stem-loop
Stem-loop
---a   gg    g  agg   a     a     -c        g 
    ucu  gcuu gc   ugg auggg ggugg  agggagaa g
    |||  |||| ||   ||| ||||| |||||  |||||||| c
    agg  cgaa ug   acc ugucc ccacc  ucccuuuu a
ggaa   --    g  ---   a     -     cc        g 
Get sequence
Deep sequencing
2 reads, 0.547 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 75551429-75551511 [+]
sense
OTTMUST00000014018 ; Slc43a2-001; intron 5
OTTMUST00000014019 ; Slc43a2-002; intron 5
ENSMUST00000042561 ; Slc43a2-001; intron 5
ENSMUST00000169547 ; Slc43a2-201; intron 5
ENSMUST00000108433 ; Slc43a2-002; intron 5
Database links

Mature sequence mmu-miR-3971

Accession MIMAT0019356
Sequence

52 - 

cuccccaccccuguaccaguga

 - 73

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [20935160]
Predicted targets

References

1
PMID:20935160 "Next-generation sequencing identifies the natural killer cell microRNA transcriptome" Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER Genome Res. 20:1590-1604(2010).