Stem-loop sequence mmu-mir-378b

AccessionMI0016973 (change log)
Symbol MGI:Mir378b
DescriptionMus musculus miR-378b stem-loop
Gene family MIPF0000168; mir-378
Literature search

77 open access papers mention mmu-mir-378b
(729 sentences)

Stem-loop
   ----u   --    gcua   c        ca  a     agg gg  gg 
5'      guc  cugg    ucc aguccagg  gu cccuc   a  ca  u
        |||  ||||    ||| ||||||||  || |||||   |  ||  a
3'      cag  gacu    agg ucaggucc  ca gggag   u  gu  c
   gaguc   aa    ---g   u        --  a     aga ag  ag 
Get sequence
Deep sequencing
9466265 reads, 9.75e+03 reads per million, 107 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 88352773-88352864 [+]
antisense
OTTMUST00000018474 ; Msi2-001; intron 11
OTTMUST00000018479 ; Msi2-006; intron 11
ENSMUST00000107909 ; Msi2-001; intron 11
ENSMUST00000092794 ; Msi2-006; intron 11
Database links

Mature sequence mmu-miR-378b

Accession MIMAT0019348
Sequence

67 - 

cuggacuuggagucagaaga

 - 86

Get sequence
Deep sequencing9466262 reads, 107 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20935160 "Next-generation sequencing identifies the natural killer cell microRNA transcriptome" Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER Genome Res. 20:1590-1604(2010).