Stem-loop sequence mmu-mir-3962

AccessionMI0016967 (change log)
Symbol MGI:Mir3962
DescriptionMus musculus miR-3962 stem-loop
Literature search

1 open access papers mention mmu-mir-3962
(1 sentences)

Stem-loop
   u   -u            --u    c  g     
5'  ggg  ugagaaauguac   cugc ac uagg 
    |||  ||||||||||||   |||| || ||| a
3'  ccc  auucuuuacaug   gaug ug aucg 
   u   uc            uuu    a  g     
Get sequence
Deep sequencing
56036 reads, 77.4 reads per million, 106 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 194822001-194822064 [+]
intergenic
Database links

Mature sequence mmu-miR-3962

Accession MIMAT0019340
Sequence

35 - 

agguaguaguuuguacauuu

 - 54

Get sequence
Deep sequencing56036 reads, 106 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20935160 "Next-generation sequencing identifies the natural killer cell microRNA transcriptome" Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER Genome Res. 20:1590-1604(2010).
2
PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).