Stem-loop sequence oar-mir-323c

AccessionMI0016962 (change log)
DescriptionOvis aries miR-323c stem-loop
Gene family MIPF0000018; mir-154
Literature search

2 open access papers mention oar-mir-323c
(2 sentences)

Stem-loop
   gcgugcugcugcacu       u            c     gccg  u  -   u 
5'                ugaugcu gaggagagguug ccgug    gu cg cau c
                  ||||||| |||||||||||| |||||    || || ||| u
3'                acuaugg cuucucuccggc ggcac    ca gc gua u
   -acguuccacccuaa       -            u     auaa  c  u   c 
Get sequence
Deep sequencing
671 reads, 138 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64563301-64563410 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-323c
oar-mir-323bchr18: 64553587-64553696 [+]
oar-mir-154achr18: 64556923-64557027 [+]
oar-mir-154bchr18: 64557232-64557340 [+]
oar-mir-496chr18: 64557719-64557837 [+]
oar-mir-377chr18: 64559316-64559445 [+]
oar-mir-541chr18: 64561254-64561367 [+]
oar-mir-3957chr18: 64561647-64561751 [+]
oar-mir-409chr18: 64562168-64562268 [+]
oar-mir-412chr18: 64562295-64562418 [+]
oar-mir-369chr18: 64562459-64562565 [+]
oar-mir-410chr18: 64562773-64562898 [+]
oar-mir-323cchr18: 64563301-64563410 [+]
Database links

Mature sequence oar-miR-323c

Accession MIMAT0019335
Sequence

65 - 

cacaauacacggucggccucu

 - 85

Get sequence
Deep sequencing669 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).