Stem-loop sequence oar-mir-412

AccessionMI0016959 (change log)
DescriptionOvis aries miR-412 stem-loop
Gene family MIPF0000192; mir-412
Literature search

1 open access papers mention oar-mir-412
(1 sentences)

Stem-loop
   agggaagaacgucaguaccagcaaccacucugg     a      a    c      u   aa    -    u 
5'                                  gguac ggacgg uggu gaccag ugg  agua auug u
                                    ||||| |||||| |||| |||||| |||  |||| ||||  
3'                                  ccaug ccuguc auca cugguc acu  ucau uaau u
   --------------------cguccgacgucac     -      g    c      c   --    g    c 
Get sequence
Deep sequencing
536 reads, 58.3 reads per million, 12 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64562295-64562418 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-412
oar-mir-668chr18: 64552683-64552787 [+]
oar-mir-485chr18: 64552826-64552936 [+]
oar-mir-323bchr18: 64553587-64553696 [+]
oar-mir-154achr18: 64556923-64557027 [+]
oar-mir-154bchr18: 64557232-64557340 [+]
oar-mir-496chr18: 64557719-64557837 [+]
oar-mir-377chr18: 64559316-64559445 [+]
oar-mir-541chr18: 64561254-64561367 [+]
oar-mir-3957chr18: 64561647-64561751 [+]
oar-mir-409chr18: 64562168-64562268 [+]
oar-mir-412chr18: 64562295-64562418 [+]
oar-mir-369chr18: 64562459-64562565 [+]
oar-mir-410chr18: 64562773-64562898 [+]
oar-mir-323cchr18: 64563301-64563410 [+]
Database links

Mature sequence oar-miR-412-3p

Accession MIMAT0019329
Sequence

47 - 

uggucgaccaguuggaaaguaau

 - 69

Get sequence
Deep sequencing500 reads, 12 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-412-5p

Accession MIMAT0019330
Sequence

83 - 

cuucaccugguccacuagcu

 - 102

Get sequence
Deep sequencing32 reads, 7 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).