Stem-loop sequence oar-mir-409

AccessionMI0016958 (change log)
DescriptionOvis aries miR-409 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   c    ------cca      g  gg   a    ac         -    - auc 
5'  cucu         ugguac cg  gag gguu  ccgagcaac uuug c   u
    ||||         |||||| ||  ||| ||||  ||||||||| |||| |    
3'  gaga         acuaug gc  uuc ccaa  ggcucguug aagc g   g
   a    cuaccuaaa      -  uu   c    gu         u    a cag 
Get sequence
Deep sequencing
9136 reads, 1.25e+03 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64562168-64562268 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-409
oar-mir-668chr18: 64552683-64552787 [+]
oar-mir-485chr18: 64552826-64552936 [+]
oar-mir-323bchr18: 64553587-64553696 [+]
oar-mir-154achr18: 64556923-64557027 [+]
oar-mir-154bchr18: 64557232-64557340 [+]
oar-mir-496chr18: 64557719-64557837 [+]
oar-mir-377chr18: 64559316-64559445 [+]
oar-mir-541chr18: 64561254-64561367 [+]
oar-mir-3957chr18: 64561647-64561751 [+]
oar-mir-409chr18: 64562168-64562268 [+]
oar-mir-412chr18: 64562295-64562418 [+]
oar-mir-369chr18: 64562459-64562565 [+]
oar-mir-410chr18: 64562773-64562898 [+]
oar-mir-323cchr18: 64563301-64563410 [+]
Database links

Mature sequence oar-miR-409-5p

Accession MIMAT0019327
Sequence

23 - 

agguuacccgagcaacuuugcau

 - 45

Get sequence
Deep sequencing2909 reads, 13 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-409-3p

Accession MIMAT0019328
Sequence

54 - 

cgaauguugcucggugaaccccu

 - 76

Get sequence
Deep sequencing6226 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).