Stem-loop sequence oar-mir-541

AccessionMI0016956 (change log)
DescriptionOvis aries miR-541 stem-loop
Gene family MIPF0000213; mir-541
Literature search

1 open access papers mention oar-mir-541
(1 sentences)

Stem-loop
   -----cugaacuugggccaac u     aaa        c    g uc    u   aa  u 
5'                      g caggg   ggauucug uguc g  ccac cca  gu c
                        | |||||   |||||||| |||| |  |||| |||  || g
3'                      c gucuc   ccuaagac acgg u  ggug ggu  ca a
   cucguccgccgcacacggugu -     cgg        -    g --    -   -a  a 
Get sequence
Deep sequencing
201 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64561254-64561367 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-541
oar-mir-382chr18: 64551749-64551874 [+]
oar-mir-134chr18: 64552132-64552238 [+]
oar-mir-668chr18: 64552683-64552787 [+]
oar-mir-485chr18: 64552826-64552936 [+]
oar-mir-323bchr18: 64553587-64553696 [+]
oar-mir-154achr18: 64556923-64557027 [+]
oar-mir-154bchr18: 64557232-64557340 [+]
oar-mir-496chr18: 64557719-64557837 [+]
oar-mir-377chr18: 64559316-64559445 [+]
oar-mir-541chr18: 64561254-64561367 [+]
oar-mir-3957chr18: 64561647-64561751 [+]
oar-mir-409chr18: 64562168-64562268 [+]
oar-mir-412chr18: 64562295-64562418 [+]
oar-mir-369chr18: 64562459-64562565 [+]
oar-mir-410chr18: 64562773-64562898 [+]
oar-mir-323cchr18: 64563301-64563410 [+]
Database links

Mature sequence oar-miR-541-5p

Accession MIMAT0019323
Sequence

24 - 

aaaggauucugcugucggucccacu

 - 48

Get sequence
Deep sequencing160 reads, 10 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-541-3p

Accession MIMAT0019324
Sequence

68 - 

uggugggcacagaauccggccucu

 - 91

Get sequence
Deep sequencing39 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).