Stem-loop sequence oar-mir-377

AccessionMI0016955 (change log)
DescriptionOvis aries miR-377 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention oar-mir-377
(2 sentences)

Stem-loop
   agagguaucuuggugcucagg   -u  ugac       c  ug   ag            -    a    - uuu 
5'                      ccc  gc    guuugau cu  agc  agguugccuuug guga uucg c   a
                        |||  ||    ||||||| ||  |||  |||||||||||| |||| |||| |   u
3'                      ggg  cg    uaaacua ga  uug  uucaacggaaac cacu aagu g   u
   --------------------a   uu  -ucc       u  gu   cu            a    -    u uau 
Get sequence
Deep sequencing
333 reads, 7.98e+03 reads per million, 14 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64559316-64559445 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-377
oar-mir-382chr18: 64551749-64551874 [+]
oar-mir-134chr18: 64552132-64552238 [+]
oar-mir-668chr18: 64552683-64552787 [+]
oar-mir-485chr18: 64552826-64552936 [+]
oar-mir-323bchr18: 64553587-64553696 [+]
oar-mir-154achr18: 64556923-64557027 [+]
oar-mir-154bchr18: 64557232-64557340 [+]
oar-mir-496chr18: 64557719-64557837 [+]
oar-mir-377chr18: 64559316-64559445 [+]
oar-mir-541chr18: 64561254-64561367 [+]
oar-mir-3957chr18: 64561647-64561751 [+]
oar-mir-409chr18: 64562168-64562268 [+]
oar-mir-412chr18: 64562295-64562418 [+]
oar-mir-369chr18: 64562459-64562565 [+]
oar-mir-410chr18: 64562773-64562898 [+]
oar-mir-323cchr18: 64563301-64563410 [+]
Database links

Mature sequence oar-miR-377-5p

Accession MIMAT0019321
Sequence

47 - 

agagguugccuuuggugaauuc

 - 68

Get sequence
Deep sequencing30 reads, 8 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-377-3p

Accession MIMAT0019322
Sequence

85 - 

aucacacaaaggcaacuuucgu

 - 106

Get sequence
Deep sequencing301 reads, 14 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).