Stem-loop sequence oar-mir-154b

AccessionMI0016953 (change log)
DescriptionOvis aries miR-154b stem-loop
Gene family MIPF0000018; mir-154
Literature search

2 open access papers mention oar-mir-154b
(5 sentences)

Stem-loop
   --a   auacuugg                   uu     -   c     - uuua 
5'    gag        ugguacuugaagagagguc  ccaug gug auucg c    u
      |||        |||||||||||||||||||  ||||| ||| ||||| |     
3'    uuc        acuauggauuuuuuuccag  gguac uac uaagc g    u
   aag   cggucuaa                   uu     a   -     a uuuc 
Get sequence
Deep sequencing
4095 reads, 523 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64557232-64557340 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-154b
oar-mir-3959chr18: 64548402-64548502 [+]
oar-mir-487achr18: 64548818-64548920 [+]
oar-mir-382chr18: 64551749-64551874 [+]
oar-mir-134chr18: 64552132-64552238 [+]
oar-mir-668chr18: 64552683-64552787 [+]
oar-mir-485chr18: 64552826-64552936 [+]
oar-mir-323bchr18: 64553587-64553696 [+]
oar-mir-154achr18: 64556923-64557027 [+]
oar-mir-154bchr18: 64557232-64557340 [+]
oar-mir-496chr18: 64557719-64557837 [+]
oar-mir-377chr18: 64559316-64559445 [+]
oar-mir-541chr18: 64561254-64561367 [+]
oar-mir-3957chr18: 64561647-64561751 [+]
oar-mir-409chr18: 64562168-64562268 [+]
oar-mir-412chr18: 64562295-64562418 [+]
oar-mir-369chr18: 64562459-64562565 [+]
oar-mir-410chr18: 64562773-64562898 [+]
oar-mir-323cchr18: 64563301-64563410 [+]
Database links

Mature sequence oar-miR-154b-5p

Accession MIMAT0019317
Sequence

25 - 

agaggucuuccauggugcauucg

 - 47

Get sequence
Deep sequencing3747 reads, 13 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-154b-3p

Accession MIMAT0019318
Sequence

63 - 

aaucauacaugguugaccuuuuu

 - 85

Get sequence
Deep sequencing348 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).