Stem-loop sequence oar-mir-134

AccessionMI0016948 (change log)
DescriptionOvis aries miR-134 stem-loop
Gene family MIPF0000112; mir-134
Literature search

7 open access papers mention oar-mir-134
(14 sentences)

Stem-loop
   ----     cagcacc   c     gu     -u   uga        gca   a 
5'     ggugu       guu agggu  gugac  ggu   ccagaggg   agc c
       |||||       ||| |||||  |||||  |||   ||||||||   ||| u
3'     ccacg       cga uccca  cacug  ccg   ggucuccc   uug c
   ccgu     ccaacca   c     ac     cu   ucg        -ac   c 
Get sequence
Deep sequencing
325 reads, 7.69 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64552132-64552238 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-134
oar-mir-381chr18: 64542580-64542707 [+]
oar-mir-487bchr18: 64543093-64543199 [+]
oar-mir-539chr18: 64543862-64543971 [+]
oar-mir-544chr18: 64545480-64545580 [+]
oar-mir-655chr18: 64546384-64546490 [+]
oar-mir-3959chr18: 64548402-64548502 [+]
oar-mir-487achr18: 64548818-64548920 [+]
oar-mir-382chr18: 64551749-64551874 [+]
oar-mir-134chr18: 64552132-64552238 [+]
oar-mir-668chr18: 64552683-64552787 [+]
oar-mir-485chr18: 64552826-64552936 [+]
oar-mir-323bchr18: 64553587-64553696 [+]
oar-mir-154achr18: 64556923-64557027 [+]
oar-mir-154bchr18: 64557232-64557340 [+]
oar-mir-496chr18: 64557719-64557837 [+]
oar-mir-377chr18: 64559316-64559445 [+]
oar-mir-541chr18: 64561254-64561367 [+]
oar-mir-3957chr18: 64561647-64561751 [+]
Database links

Mature sequence oar-miR-134-5p

Accession MIMAT0019308
Sequence

23 - 

ugugacugguugaccagaggg

 - 43

Get sequence
Deep sequencing319 reads, 13 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-134-3p

Accession MIMAT0019309
Sequence

63 - 

ucugggcugccucgucaccaacc

 - 85

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).