Stem-loop sequence oar-mir-487a

AccessionMI0016946 (change log)
DescriptionOvis aries miR-487a stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention oar-mir-487a
(4 sentences)

Stem-loop
   ---gu   cc         u     g   cua      c    -    cu  a 
5'      uag  uuugguacu gaaga ugg   ucccug ugug uucg  gu u
        |||  ||||||||| ||||| |||   |||||| |||| ||||  ||  
3'      guc  aaacuauga uuuuu acc   agggac auac aagc  ua u
   gucuc   au         c     g   uac      -    u    ag  u 
Get sequence
Deep sequencing
475 reads, 76.9 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64548818-64548920 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-487a
oar-mir-376achr18: 64538968-64539070 [+]
oar-mir-1185chr18: 64540919-64541024 [+]
oar-mir-3956chr18: 64541653-64541781 [+]
oar-mir-381chr18: 64542580-64542707 [+]
oar-mir-487bchr18: 64543093-64543199 [+]
oar-mir-539chr18: 64543862-64543971 [+]
oar-mir-544chr18: 64545480-64545580 [+]
oar-mir-655chr18: 64546384-64546490 [+]
oar-mir-3959chr18: 64548402-64548502 [+]
oar-mir-487achr18: 64548818-64548920 [+]
oar-mir-382chr18: 64551749-64551874 [+]
oar-mir-134chr18: 64552132-64552238 [+]
oar-mir-668chr18: 64552683-64552787 [+]
oar-mir-485chr18: 64552826-64552936 [+]
oar-mir-323bchr18: 64553587-64553696 [+]
oar-mir-154achr18: 64556923-64557027 [+]
oar-mir-154bchr18: 64557232-64557340 [+]
oar-mir-496chr18: 64557719-64557837 [+]
Database links

Mature sequence oar-miR-487a-5p

Accession MIMAT0019304
Sequence

23 - 

guggcuaucccugcuguguucg

 - 44

Get sequence
Deep sequencing77 reads, 12 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-487a-3p

Accession MIMAT0019305
Sequence

60 - 

aucauacagggacauccaguuu

 - 81

Get sequence
Deep sequencing396 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).