Stem-loop sequence oar-mir-381

AccessionMI0016940 (change log)
DescriptionOvis aries miR-381 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention oar-mir-381
(2 sentences)

Stem-loop
   agcgauggaccugcccaaugcuacuacu            a  c   g        u        --g   u 
5'                             guuugguacuua ag gag uugcccuu guauauuc   guu u
                               |||||||||||| || ||| |||||||| ||||||||   |||  
3'                             caaacuaugagu uc cuc aacgggaa cauauaag   cag u
   ---------------cugacccaggucc            g  u   g        -        acg   u 
Get sequence
Deep sequencing
255 reads, 23.1 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64542580-64542707 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-381
oar-mir-495chr18: 64532840-64532965 [+]
oar-mir-3958chr18: 64534803-64534906 [+]
oar-mir-376echr18: 64537482-64537587 [+]
oar-mir-376cchr18: 64537853-64537957 [+]
oar-mir-376dchr18: 64538218-64538327 [+]
oar-mir-654chr18: 64538374-64538478 [+]
oar-mir-376bchr18: 64538600-64538705 [+]
oar-mir-376achr18: 64538968-64539070 [+]
oar-mir-1185chr18: 64540919-64541024 [+]
oar-mir-3956chr18: 64541653-64541781 [+]
oar-mir-381chr18: 64542580-64542707 [+]
oar-mir-487bchr18: 64543093-64543199 [+]
oar-mir-539chr18: 64543862-64543971 [+]
oar-mir-544chr18: 64545480-64545580 [+]
oar-mir-655chr18: 64546384-64546490 [+]
oar-mir-3959chr18: 64548402-64548502 [+]
oar-mir-487achr18: 64548818-64548920 [+]
oar-mir-382chr18: 64551749-64551874 [+]
oar-mir-134chr18: 64552132-64552238 [+]
Database links

Mature sequence oar-miR-381-5p

Accession MIMAT0019292
Sequence

42 - 

agcgagguugcccuuuguau

 - 61

Get sequence
Deep sequencing15 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-381-3p

Accession MIMAT0019293
Sequence

82 - 

auauacaagggcaagcucucu

 - 102

Get sequence
Deep sequencing240 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).