Stem-loop sequence oar-mir-3956

AccessionMI0016939 (change log)
DescriptionOvis aries miR-3956 stem-loop
Gene family MIPF0001577; mir-3956
Stem-loop
   -uggg        c      ccag u   u      -u            gaagugcu    -ucuc  c 
5'      agccaucg ccuggg    g acg ggaugc  gaaggucagagg        ucug     ca g
        |||||||| ||||||    | ||| ||||||  ||||||||||||        ||||     ||  
3'      ucgguagu ggaucu    c ugc ccuacg  cuuccagucucc        ggac     gu u
   gaaga        a      -cua u   -      uc            --------    cucuu  g 
Get sequence
Deep sequencing
28 reads, 1.25e+04 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64541653-64541781 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-3956
oar-mir-495chr18: 64532840-64532965 [+]
oar-mir-3958chr18: 64534803-64534906 [+]
oar-mir-376echr18: 64537482-64537587 [+]
oar-mir-376cchr18: 64537853-64537957 [+]
oar-mir-376dchr18: 64538218-64538327 [+]
oar-mir-654chr18: 64538374-64538478 [+]
oar-mir-376bchr18: 64538600-64538705 [+]
oar-mir-376achr18: 64538968-64539070 [+]
oar-mir-1185chr18: 64540919-64541024 [+]
oar-mir-3956chr18: 64541653-64541781 [+]
oar-mir-381chr18: 64542580-64542707 [+]
oar-mir-487bchr18: 64543093-64543199 [+]
oar-mir-539chr18: 64543862-64543971 [+]
oar-mir-544chr18: 64545480-64545580 [+]
oar-mir-655chr18: 64546384-64546490 [+]
oar-mir-3959chr18: 64548402-64548502 [+]
oar-mir-487achr18: 64548818-64548920 [+]
Database links

Mature sequence oar-miR-3956-5p

Accession MIMAT0019290
Sequence

24 - 

guacguggaugcugaaggucaga

 - 46

Get sequence
Deep sequencing21 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-3956-3p

Accession MIMAT0019291
Sequence

84 - 

ucugaccuuccugcaucccguuc

 - 106

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).