Stem-loop sequence oar-mir-376d

AccessionMI0016934 (change log)
DescriptionOvis aries miR-376d stem-loop
Gene family MIPF0000091; mir-368
Stem-loop
   gggauccauccu          u    g  a         u         cgg   u 
5'             guuugguauu aaaa gu gauuuuccu cuaugguua   guu g
               |||||||||| |||| || ||||||||| |||||||||   |||  
3'             uaaacuauga uuuu ca cuaaaagga gauacuaau   uag g
   --gguuucgucg          c    a  c         -         ---   u 
Get sequence
Deep sequencing
16216 reads, 3.18e+03 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64538218-64538327 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-376d
oar-mir-494chr18: 64529077-64529173 [+]
oar-mir-1193chr18: 64529620-64529722 [+]
oar-mir-543chr18: 64531404-64531526 [+]
oar-mir-495chr18: 64532840-64532965 [+]
oar-mir-3958chr18: 64534803-64534906 [+]
oar-mir-376echr18: 64537482-64537587 [+]
oar-mir-376cchr18: 64537853-64537957 [+]
oar-mir-376dchr18: 64538218-64538327 [+]
oar-mir-654chr18: 64538374-64538478 [+]
oar-mir-376bchr18: 64538600-64538705 [+]
oar-mir-376achr18: 64538968-64539070 [+]
oar-mir-1185chr18: 64540919-64541024 [+]
oar-mir-3956chr18: 64541653-64541781 [+]
oar-mir-381chr18: 64542580-64542707 [+]
oar-mir-487bchr18: 64543093-64543199 [+]
oar-mir-539chr18: 64543862-64543971 [+]
oar-mir-544chr18: 64545480-64545580 [+]
oar-mir-655chr18: 64546384-64546490 [+]
Database links

Mature sequence oar-miR-376d

Accession MIMAT0019281
Sequence

66 - 

aucauagaggaaaauccacau

 - 86

Get sequence
Deep sequencing16030 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).