Stem-loop sequence oar-mir-3958

AccessionMI0016931 (change log)
DescriptionOvis aries miR-3958 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention oar-mir-3958
(1 sentences)

Stem-loop
   -------cu   c ga    uuc            u     au         uua 
5'          ggu u  gaug   gaaaggagguug ccgug  guauuugcu   u
            ||| |  ||||   |||||||||||| |||||  |||||||||    
3'          ccg a  cuac   cuuuucucuagu ggcac  uauagacgg   u
   gaaguucuu   u aa    -uu            u     gu         ugu 
Get sequence
Deep sequencing
2517 reads, 592 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64534803-64534906 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-3958
oar-mir-323achr18: 64524877-64524977 [+]
oar-mir-758chr18: 64525175-64525274 [+]
oar-mir-329bchr18: 64525872-64525995 [+]
oar-mir-329achr18: 64526187-64526290 [+]
oar-mir-494chr18: 64529077-64529173 [+]
oar-mir-1193chr18: 64529620-64529722 [+]
oar-mir-543chr18: 64531404-64531526 [+]
oar-mir-495chr18: 64532840-64532965 [+]
oar-mir-3958chr18: 64534803-64534906 [+]
oar-mir-376echr18: 64537482-64537587 [+]
oar-mir-376cchr18: 64537853-64537957 [+]
oar-mir-376dchr18: 64538218-64538327 [+]
oar-mir-654chr18: 64538374-64538478 [+]
oar-mir-376bchr18: 64538600-64538705 [+]
oar-mir-376achr18: 64538968-64539070 [+]
oar-mir-1185chr18: 64540919-64541024 [+]
oar-mir-3956chr18: 64541653-64541781 [+]
oar-mir-381chr18: 64542580-64542707 [+]
oar-mir-487bchr18: 64543093-64543199 [+]
oar-mir-539chr18: 64543862-64543971 [+]
Database links

Mature sequence oar-miR-3958-5p

Accession MIMAT0019275
Sequence

23 - 

agguuguccgugauguauuugc

 - 44

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-3958-3p

Accession MIMAT0019276
Sequence

57 - 

agauauugcacgguugaucucu

 - 78

Get sequence
Deep sequencing2509 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).